No AI Training
Your sequence, analysis, and AI chat data is not used to train AI models.
AI-POWEREDDNA Sequence Analysis & Surveillance
From BLAST alignments to answers - in minutes.
Every molecular diagnostics lab runs NCBI BLAST. None of them get an answer - just raw data. Until now.
QUERYACGTTGCACCTAGGATCGTACGTTAGC
|||||||| |||||| ||| |||| |||||
MZ272079ACGTTGCACCTAGGATCATACGTTAGC
PV810227ACGTTGCACCTAGGATCATACGTTAGC
MK390870ACGTTGCACCTAGGATCGTACGTTAGC
HF930495ACGTTGCACCTAGGATCGTACGTTAGC
Primer / probe 1,284 detected 2 mismatches
INCLUSIVITY
99.4%↑
DETECTION RATE
1,284/ 1,292
See it in action
Watch BLASTseq AI run a full analysis
From sequence input to analysis reports in minutes — see the complete in silico workflow.
BLASTseq AI demo · 2 min Capabilities
Everything your in silico workflow needs, automated by AI
From BLAST alignments to shareable reports — BLASTseq AI replaces days of manual bioinformatics work.
01
Supercharge In-Silico Analysis & Assay Performance
- Automate Surveillance: Streamline post-market reporting for DNA/RNA assays.
- Accelerate Analysis: Complete BLAST alignments and variant checks in minutes.
- Optimize Design: Run smart in-silico inclusivity and exclusivity screening.
- Predict Performance: Accurately forecast primer/probe binding for qPCR.
02
Automate Primer-Probe Verification & Surveillance
- Inclusivity & Exclusivity: Ensure your assay detects the exact target of interest while automatically excluding cross-reactive species to prevent false positives.
- Precise Alignment Data: Instantly view oligonucleotide binding locations, homology data, and amplifiability across all accessions.
- Optimize Wet Testing: Accelerate laboratory work with AI-calculated overall detection rates based on precise primer-probe binding regions.
03
Accurate Variant Calling & Annotation
- Pinpoint Anomalies: Confidently identify genetic variations, mutations, and sequence anomalies using advanced, highly accurate algorithms.
- NCBI Database Integration: Automatically detect mutation and variant sequences for your specific amplicon or target within the NCBI BLAST database.
- Streamlined Grouping: Accelerate your workflow with results automatically grouped by identical sequences, so you can instantly identify and download relevant accessions.
- Detailed Performance Checks: Generate comprehensive, automated reports to verify assay performance and confirm inclusivity/exclusivity parameters.
04
AI Summary Reports & Data Visualization
- Intelligent Data Parsing: Instantly sort and separate your results into “detected” and “not detected” accession groups for rapid analysis.
- Automated Reporting: Generate customizable, comprehensive reports detailing inclusivity, exclusivity, and mutation/variant analysis with zero manual effort.
- Actionable Clarity: Transform dense genomic data into clear, team-ready summaries that highlight your most critical findings.
- Share Analysis: Instantly share your analysis and reports with other users.
Explore the output
See what BLASTseq AI produces
Every run delivers structured, interrogable output — from raw alignments to detection groups, inclusivity/exclusivity summaries, and variant calls.
Description
A detailed tabulation of BLAST search results — a comprehensive overview of identified sequences and their characteristics across all matched accessions.
Accessions matched1,292
Mean query cover100%
Top taxonAcanthamoeba
| Sr | Description | Query cover | E-value | Identity | Accession |
|---|---|---|---|---|---|
| 1 | Acanthamoeba sp. isolate AcW110A small sub… | 100% | 9.9e-85 | 100% | MZ272079 |
| 2 | Acanthamoeba sp. isolate LC6M4 small subu… | 100% | 9.9e-85 | 100% | PV810227 |
| 3 | Acanthamoeba sp. isolate ZWR-16-Q2-D 18S… | 100% | 9.9e-85 | 100% | MK390870 |
| 4 | Acanthamoeba sp. AcL-BL11 partial 18S rRNA… | 100% | 9.9e-85 | 99.6% | HF930495 |
| 5 | Acanthamoeba sp. AC6 gene for 18S rRNA, p… | 100% | 9.9e-85 | 99.6% | AB554223 |
| 6 | Acanthamoeba genotype T4 small subunit rib… | 100% | 9.9e-85 | 100% | OR364831 |
| 7 | Acanthamoeba genotype T4 isolate Chon3 18… | 100% | 9.9e-85 | 100% | KF733235 |
Alignments
Detailed sequence alignments showing how the query aligns against each matched accession, with mismatches highlighted base-by-base.
Aligned length28 bp
Conserved26 / 28
Mismatches2
QueryACGTTGCACCTAGGATCGTACGTTAGCACGT
|||||||| |||||| ||| |||||| |||||| ||
MZ272079ACGTTGCACCTAGGATCATACGTTAGCACGT
PV810227ACGTTGCACCTAGGATCATACGTTAGCACGT
MK390870ACGTTGCACCTAGGATCGTACGTTAGCACGT
HF930495ACGTTGCACCTAGGATCGTACGTTAGCACGT
AB554223ACGTTGCACCTAGGATCGTACGTTAGCACGT
OR364831ACGTTGCACCTAGGATCGTACGTTAGCACGT
Primer / Probe alignment
Oligonucleotide binding locations and PCR amplifiability per accession.
Fwd primer Tm61.2°C
Probe binding98.7%
Amplifiable1,284
| Accession | Fwd primer | Probe | Rev primer | Amplifiable |
|---|---|---|---|---|
| MZ272079 | bind | bind | bind | Yes |
| PV810227 | bind | 1 mm | bind | Yes |
| MK390870 | bind | bind | bind | Yes |
| HF930495 | 2 mm | bind | bind | Partial |
| AB554223 | bind | bind | no | No |
| OR364831 | bind | bind | bind | Yes |
Detection groups
Accessions categorised by detection status — instantly assess the outcome of organism detection across your full result set.
Total accessions1,292
Detection rate99.4%
99.4%
DETECTED
Detected1,284
Further analysis6
Not detected2
Grouped, deduplicated & ready to download as a report.
Inclusivity analysis
In-silico inclusivity & exclusivity summary — confirm your assay detects the target while excluding cross-reactive species.
Inclusivity99.4%
Exclusivity100%
| Target organism | Accessions | Detected | Inclusivity | |
|---|---|---|---|---|
| Acanthamoeba T4 | 842 | 840 | 99.8% | |
| Acanthamoeba T3 | 214 | 212 | 99.1% | |
| Acanthamoeba T5 | 156 | 154 | 98.7% | |
| Acanthamoeba T11 | 80 | 78 | 97.5% | |
| Off-target spp. | 3,401 | 0 | excluded |
Variant analysis
Assessment of insertions, deletions and mismatches, and their impact on assay specificity and target detection.
Variants found14
Impacting detection2
| Position | Type | Change | Frequency | Impact |
|---|---|---|---|---|
| probe +12 | SNP | G → A | 2.1% | Reduced |
| fwd +4 | SNP | C → T | 0.6% | None |
| rev +18 | Deletion | −AG | 0.2% | Detection loss |
| amp +71 | SNP | T → C | 4.8% | None |
| amp +96 | Insertion | +T | 0.1% | None |
How it works
Three steps from sequence to signed-off report
Paste your sequence
Drop in your primer, probe or amplicon sequence — or an existing assay design. No file wrangling, no setup.
> target: primer_fwd
> seq: ACGTTGCACCTAGG…
> db: NCBI nt
AI runs BLAST & filters
BLASTseq aligns against the live NCBI database, applies taxonomy-based filtering, and groups identical hits automatically.
▸ aligning 1,292 accessions…
▸ taxonomy filter applied
✓ grouped & deduplicated
Get the report
Inclusivity, exclusivity and variant findings in a clean, shareable report — ready for your team or submission file.
✓ inclusivity 99.4%
✓ exclusivity 100%
⤓ report.pdf ready
Privacy & data security
Your Scientific Data Stays Private
BLASTseq AI protects sensitive assay and sequence information throughout the analysis workflow. Your primers, probes, query sequences, analysis results, and AI chat content are not used to train AI models. Data is encrypted during transmission and storage. All run and analysis data is automatically removed after 7 days, and users can also manually delete their data at any time.
Encrypted Data
Scientific data is encrypted during transmission and storage.
7-Day Automatic Deletion
All run and analysis data is automatically removed after 7 days.
Delete Anytime
Users can manually delete run and analysis data before the seven-day period ends and can manually delete AI chat sessions.
<3min
Avg. analysis time
62K+
Citations
350K+
Labs worldwide
100/day
Search cap
Early access feedback
Built with feedback from research and assay-development teams.
★★★★★
“I've been manually interpreting BLAST results for years. BlastSeq.AI gave me the same answer in under two minutes. I didn't think that was possible.”
MB
Molecular Biologist
Diagnostics Lab · Early Access User
★★★★★
“The inclusivity screening alone saves me an entire day of work per assay. This should have existed a long time ago.”
AS
Assay Development Scientist
Early Access User
★★★★★
“What I appreciated most was that it didn't just give me a score — it explained the result. That's what we actually need when writing up validation reports.”
RD
R&D Scientist
Molecular Diagnostics · Early Access User
★★★★★
“We run BLAST on every primer and probe we design. BlastSeq.AI has completely changed how fast we can move from sequence design to validation decision.”
SS
Senior Scientist
PCR Assay Development · Early Access User
Pricing
Flexible plans for individual researchers and enterprise teams
Start free and pay as you go, or subscribe for a monthly credit allowance. Pricing is per user. AI chat credits are charged based on the effort required for each interaction, while each structured report type costs 200 credits to unlock.
Basic
Best for researchers starting out.
$0/forever
Buy credits as you go
20 welcome credits on signup
Sign up free - Dashboard analytics
- AI assistant access (credits)
- Unlock reports with credits
- Share analysis runs
- Monthly subscription credits
Pro
For individual researchers running regular analyses.
$95per user / month
200 credits / month
20 welcome credits on signup
Start Pro - Everything in Basic
- 200 monthly credits included
- Download grouped variant reports
- Buy additional credits anytime
- Chat & email support
Teams
For collaborative org workflows & shared reports.
$195per user / month
400 credits / month
20 welcome credits on signup
Start Teams - Everything in Pro
- 400 monthly credits included
- Share runs & reports across org
- Higher credit allocation
- Chat, email & phone support
🎁 20 welcome credits on signup — plus an extra 200 bonus credits on your first purchase of 20+ credits.
FAQ
Questions & answers
Everything you need to know about how BLASTseq AI fits your workflow.
Browse all FAQsWhat is BLASTseq AI?
BLASTseq AI is an AI-powered in-silico sequence analysis platform that automates NCBI BLAST-based sequence alignment review, taxonomy filtering, mutation analysis, and report generation for molecular labs.
Who can use BLASTseq AI?
BLASTseq AI is intended for research use by molecular diagnostics companies, PCR assay developers, bioinformatics teams, and molecular labs to analyze performance of primer, probe, or amplicon sequences.
How does BLASTseq AI work?
It combines NCBI BLAST database live queries with structured filtering, taxonomy grouping, mismatch review, variant analysis, and AI-assisted analysis & reporting.
Is it cloud-based or locally installed?
BLASTseq AI is a cloud-hosted solution with no local installation required. Enterprise-specific cloud deployment or on-prem options can be enabled with paid customizations.
What types of analysis can it perform?
It supports primer, probe, and amplicon validation; inclusivity and exclusivity review; mismatch and mutation identification; taxonomy-based filtering; and accession grouping.
How do credits and usage work?
Credits are required for AI use and to unlock reports. New users start with 20 free signup credits.
Supercharge your BLAST analysis & assay-performance with AI
Sign up for free or play in our sandbox with no credit card or commitment required.
Built for assay development, bioinformatics, biotech, and life-science research teams